Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh6a01
Contig Information
Length 379 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh6a01   
Homology (BLAST) Top Hit putative glutamate decarboxylase 1 [Triticum aestivum]
Score 286
Evalue 2.06376e-24
Total Hit Count 43
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh6a01
ACACATACATGACATAAATATTACTCAGATCGATCCAATGGAGCCAGAACTATTAGNTTCCGTCCTCGTAAAAAATCATCATGGACAAGAGAAGTAGTAG
CAGCTTAAATTAGGAAATACAACCATAAAGATCGAGCAGCAGCTATAGCATCATCAAACGCCAGCAGCAGGTGAGAGGTGCATGGCCGCCGCTCAGCAGA
CGCCCTGGGTCTTCTTCCTGGCGGCGACGGCCCTCTTCCAGACGGACACCACCTCGCGCTGCCTGGCGAGGTCCTTCTCGCTCACCGTGTCGCCGTTGGG
GTGCTGCAGGGCGGGNCCGCTGCTGCGCNAGGGGAGCNCGTCNAGCTCGTGGAGCACCTTCTCGATGTCNCATGACGCA
page-top