Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh17l08
Contig Information
Length 252 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh17l08   
Homology (BLAST) Top Hit anther-specific proline-rich protein APG precursor [Zea mays] (no hit)
Score 642
Evalue 3.47999e-65
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh17l08
ACATGNAACTCGTACGTGATACAGACNAGGCTACAGCAGANAGGTGTTCCCTANAGAGAGAGATCCTCAAGCACAAGGAACAAAACGCACAATTAAACAC
ATGACACACCTCANAGCTGCTGTCATCTAATAAGAATATAATATGACCTAGAACGGAAACAAAGAATCAGCTATATATGCCCCCCAAGAACAGGGGAGAG
AAGAGATCGATGTCACCAAACAAGGAGTAAAGGTGAACACACACTANGGCAC
page-top