Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh11b21
Contig Information
Length 786 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh11b21   
Homology (BLAST) Top Hit anther-specific proline-rich protein APG precursor [Zea mays]
Score 642
Evalue 3.47999e-65
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whvh11b21
CCGATCCGGCCTAGCTCCATTGCTGCTAGCTAGCTGCATTCGGTTGAGACCAACCAGCAACCACACACTACAGCTCATTACTCACTAGCAGTAGCAGCGA
TGAGGGAGTTGCGGCTGCAGCAGCTCGCCGCCGTCGTGGCGGTACTGGCGTTAGTGGCGGCGGTGCGTCCGGCTGTGTGCCGGGAGCAGCAGAACAACGG
TACGTTGGAGGTGGCAGGGGAGGAGACGCGGAGTGCGAGGGCGACGGCGGTGATCGTGTTCGGCGACTCCATCGTGGACCCGGGGAACAACAACAACCTG
CACACCCAGATCAAGGCCAACCACGCGCCCTACGGCAAGGACTTCGACGGCCACCTCGCCACCGGCCGCTTCTCCAACGGCCTCGTGCCCTCCGACCTCC
TCGCCCAGAAACTTCACGTGAAGAAGCTGGTTGCTCCGTGGCTCAACGTCGACCACACTCCGGAGGACCTCCTCACCGGAGTCAGCTTCGCCTCCGGCGC
CACCGGATATGACCCACTCACTCCAAAAATCGTGAGTGTGATCACGCTGGAGCAGCAGCTGGAGTACTTCGATGAGTACCGCAACAAACTAGTGGCCATC
GCCGGCGAGGAGGAGGCCGAGAGGATCATCGATGGCGCCTTCTTTTTCGTGTGTGCCGGCTCGGATGACATCGCTAACACCTACTTCACCACACCGTTTC
GGAGCGTGCAGTACGACATCCCGTCCTACGTGGACCTCCTCCTCGTTGGTGTGGACAAGTTCCTCCGAANCGTGAGTGCACGCGGC
page-top