Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh7p04
Contig Information
Length 794 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh7p04   
Homology (BLAST) Top Hit hypothetical protein OsI_24385 [Oryza sativa Indica Group]
Score 1234
Evalue 7.97784e-134
Total Hit Count 114
Registered year 2003
Contig Sequence     [ Download ]
>whvh7p04
TTGGCGATGTTGGTGATCCTTTGGCTGTGCAATCGGCCGTGTCAGGTTGCAGCAAGATTATCTATTGCGCAACCGCGCGCTCAACCATTACCGGGGACCT
CAACAGAGTTGATAACCAAGGGGTCAGGAATGTCAGCAAGGCTTTCCAGGATTACTACAATGAGATGGCTCAGCTCAGGGCTGGTAAAAGCAGCAAGAGC
AAACTTTTGATAGCAAAATTTAAATCTGCTAAGTCTCTGAAGGGTTGGGAGGTGAACCAGGGATCTTACTTCCCGAATGCCTATGCTTCTGGTTCTAGTT
TTGATGAAGGTATCGATGCGTCCTTTGAATTTTCAGAAGGTGGCCAGGCCGTTTTTGCAGGATTTGTTTTTACAAGAGGTGGATATGTCGAGATATCAAA
GAGGCTATCTCTCCCTTTAGGTTCCACCCTAGACAGGTATGATGGCTTGCTTCTTTCAGTGGGTGGAAATGGAAGATCATATGTTGTTATTCTTGAGACT
GGTCCACTGGCTGACACCTCACAGAGTAAGAAGTATTTTGCTCGGATGACTACAAAAGTAGGCTTTTGTAGGGTAAGAGTACCTTTCTCGGCTTTCCGTC
CAGTAAAACCAGAAGATCCTCCCCTAGACCCTTTTCTTGTGCATACCTTCACCATTANGTTTGAACCAAAAAGGCAGAGACCTGGTGATGGAACCCAAGG
TGCCACTGACCCCANAAATTTTGAGCTGATACTGGAGTACATCAAAGCTTTACCTACCGGTCAAGAAACANACTTCATACTGGTCTCATGCACA
page-top