Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh11b04
Contig Information
Length 496 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh11b04   
Homology (BLAST) Top Hit SET domain containing protein [Tetrahymena thermophila SB210] >gi|89284034|gb|EAR82104.1| SET domain containing protein [Tetrahymena thermophila SB210]
Score 79
Evalue 2.1881
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>whvh11b04
CGACACCCCATCCACTTTATCTCAGTTGAGAGGTTTAGAAGCGGTGAAGCACAGGTGCAGCAAGAGCTGCGAGAGGAAGGAGCGAGCAGCAATGGCGAGG
CACAGCCTCCTTGCCGTGCTCCTCGTCGGGCTGGTCGCGGCCTCTGGTTTCAGCCAGGCCGCCGCCGCTGGTCGGGGCCTCGCCGAGAAGCTCCCCGAGC
CGGAGCCCAAGCCGATGCCGTACCCGGAGCCCAAGCCGGAACCCAAGCCAGAGCCAATGCCTAAGCCTGAACCCATGCCAAAGCCAGAGCCTAAGCCTCT
GCCTAAGCCTGAACCCATGCCAAAACCAGAGCCTAAGCCTCTGCCCAAACCTGAACCCATGCCNAAGCCAGAGCCCAAACCGGAGCCGAAGCCGGAGCCG
ATGCCNAATCCCNANNCAAAGCCTGATCCCAATCCTGANCCGATGCCCAAACCTGAGCCTAAGCTTGAGCCCNAGCCTGGAGNCGATGCCCAAACC
page-top