Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh7p20
Contig Information
Length 598 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh7p20   
Homology (BLAST) Top Hit tyrosyl-tRNA synthetase [Zea mays]
Score 484
Evalue 4.05647e-47
Total Hit Count 275
Registered year 2003
Contig Sequence     [ Download ]
>whvh7p20
AATTTGAAGATAAAGCAAGCTTTCTGTCCTCCCAAAATTGTTGATAAAAATCCGTGCCTGGAGTACATCCAGTACATTGTTTTCCCTTGGTTTGACAAGT
TTGAGGTTGTCCGCAAAGAAAACAATGGCGGTAACAAGACATTTTTAACCATGGATGAGCTTGTTGCTGATTATGAAGCGGGTGGTTTGCATCCTGCCGA
CGTTAAACCTGCTTTGGCGAAAGCGATCAATGAAATATTGAAGCCTGTTCGTGACCACTTCAACAGCAGCAGTGAAGCCAAAATTCTCCTCAATACTGTT
AAGAAGTACAGGGTAAGCAATTGAGGAGCAAATACCTTCCTGGTCATTACATGGACACCCAACAGACAATGGAAGCATACACATTTTGGTTGGCAGAGTT
TCGTGGGCACAATTTTTGGCAATACTAATACCTCTATTGCTGATATGCATCAGAAACTGTCGTGATTATGTTGATCAGTGTACAATATCTTTGCGTGTCA
CCTTCAATTGAGAAGTTATAAGACGCTTGGCGTGACATTGTAGCTAACATTTAAGGTAAACGCATTAAATCAGGCGACTGATTTTGTCAAAAAAAAAA
page-top