Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh7d24
Contig Information
Length 791 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh7d24   
Homology (BLAST) Top Hit conserved hypothetical protein [Chaetomium globosum CBS 148.51] >gi|88182284|gb|EAQ89752.1| conserved hypothetical protein [Chaetomium globosum CBS 148.51]
Score 87
Evalue 0.795855
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>whvh7d24
ATTGCTATGCCATCTGGTTTGTCGCTTTTTTTTGTTTTGTTCTATTTGTTTTTGCTGGTTTTGCTCGGTTTCTTCCTGCTCTCCGTTTTCTCCGCGTGTC
CCGTGCTCTCTCGATCCTCTCATCTCTTCTCGAGGGCTCCCGTCGAATCCGGTGCCACCGCCCACCGTCGTAGGTGACTATAAATGATCCTTCTCCCCGA
CGGTCCCTACCTCAACTCCTTCCCACCCATCCCTATGCTCCGCCCCGCCATCTTCTCTCGGTGTGGCCATATGGCATATGGGAAGCGGGCATGGAGGGCA
CGGCTGGGGCGGGGCCACCAGCGGCAGCCATCTCCATCACCGCATCATGATTCCGTCTCGGAGCAGCAGCGGAGGCGATGTCCTGGCATCCTCTTTCCCA
ACCGTCGAGGAGGACTGCCGCGACTCTTTCCATGGGGCTTCCGAGATGTTGACCGGGTTCTTGCACCGGCGGCTGCCTGAGAGGGACGCCCAGAGATACA
TGGCCTTGAATTGGACCATCACCAGCATCTGATCCTCTTCGTGGTGGCCATGAGGTAGGGCGTCGTCAAGACCCAGTCCCGCAAGTTGCAGTTCACCTGT
CACTATATCTGTTGGTTATGTAAGTGCATATGGACTACAAAAGGTGAACTCACATGAGGTCTTTTGCTCTTCCCTCTTCTGCAGCTATTTTTCTAGGGTT
TTTTTGGTAATCTTAACATCCATGAAATGGCANCAAGATGCATGTTAATGGTACTCTTAACCATATATTTATTTTAAATTGTTAANAATTT
page-top