Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh17l10
Contig Information
Length 379 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh17l10   
Homology (BLAST) Top Hit inositol-3-phosphate synthase [Zea mays]
Score 495
Evalue 1.2015e-48
Total Hit Count 281
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh17l10
AGGAACCATGGGTGCCTTGGTGANGTANCTCATGATGGTGGCAACCNGATGGAAGGAATGGAANTTGTCCTCTCNCTCGGCCTTCANNTGAATCCTGGTG
CTGAGCTCCGCCAGGAGCACCAGATCAAGAATGATGGGTGCAGCGAGGAGCGAGTCCTCGCAGGTGTTGTGCAGCACGATGGTGCTCTTGCCCCCCATGA
AGATCTCCGAGGTGTACTCGTCCATGGCCNTCTTGCTGTCTCCAACGTATGGCACGTACTTGATCACNACGACGTGGTCANGATGCTCCCCGGGCTCGTA
NAGGATANCATTGCTCGAGACCATGTCATCCACCACATTGCTCTTGGANATCTCCTTGGNAACGGAATGTCTGCGGNGC
page-top