Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh7c21
Contig Information
Length 674 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh7c21   
Homology (BLAST) Top Hit OSJNBa0068L06.4 [Oryza sativa (japonica cultivar-group)]
Score 150
Evalue 2.97241e-11
Total Hit Count 94
Registered year 2003
Contig Sequence     [ Download ]
>whvh7c21
AATTACTGCCGCGCTCACACCTAGCATGCCGTCAGCCCGTGCCTCGCCATTGGCCACCGCCAGTCCCCCGGCGTGGCCCGTGGACTCTCCATCACGGCCT
TCTCCGACGGGGCCAACCGGTTGACATTGCTGCGGCGGATGGTGGTGTGCGCCAGCGCACAGGCACAGAAGCATGCAGGCGGAGAACGGCTGTTCCGGCG
ACGCGCTGCGCAAGGCCACCAAATTCCTCGAGGACCGCCTCGACCGCAACCCCGTCACACCCGTCATGCTAATGTCGGACACGCAACAGCAAAGCTCGAG
GAAACGCGACGGTGACAACGCGCTTGACGCAGGTGAGGATCCTCGGCCGACGACACGCCGGTTTGGTCGCCCCCTGCGTCCAAGCAGGAGCACCCACTGG
AGTCCAGCGCTTCCGCGGAGCACGCCATGCGTTCGCAAAGTGACTCGGCGGCCTGGTCAGCGCGTCATGCAGGAGGTACCCCATCTGGTGTATGATGGAG
GTAACACCGATGGCGAGCTAGAGGTGCCGCGAGGTGATCAGCTAACAGAAGGGGTACGGCGTGGTGTTCCTCAAGAGCGGGTAGGAGTTGGACGTGGACG
ATGCANAAGGTGANAGGTCCTCCANGAGGCCANCGACCGCGGGGACACCGGCAAGGTGTGCTCCACTGCTGGCA
page-top