Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh17l16
Contig Information
Length 866 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh17l16   
Homology (BLAST) Top Hit ribosomal protein-like [Oryza sativa Japonica Group]
Score 206
Evalue 2.11836e-28
Total Hit Count 121
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh17l16
ACTATTCTCTAGGCTTATTACAGGAGATGCTCCTTCTTGCAAATACTCGGTCAATGGGCACAACTACTTGATGGGTTACTACCTTGCGGATGGCATCTAT
CCACAATGGACCGCCTTGGTCAAAACAAAATATTCACTTTATCCAATGTCAAGAAGCTGCTAGCAAAGATGTGGAGAGAGCCTTCGGTGTGCTTCGGAAG
CGCTTTGTAATTGTTCGTGTCCCTACCGAGTACTAGAGCTCCAAGGTTCTATGGCGGATCATGACTTGTTGCATCATATTTCATAACATCATCATTGAAG
ACAAGAGGGATCTGCCTGAGAACTTTTGGTACATCACCAATGGGACTCCAGTTGAGGCAGAGTAATATATGAACAGGATCCTGGCATTCCTTGAAGAGCA
TCGCAAGATTGAGAACCGACATGTTCCTGCTCAACTCCAAGAAAATCTTATTAAGCATCACTGGCAACGTCATAGTGAGTCCTGTTATTTTATCACATGT
TTTTCGATACATTTGGACCATTTGGTGTGTTCAAATTTGAATAATTCGGTTTGTAGTCTTTAAATTTGGTGTGTATACTATATTCGTGATTTGCTTGAAC
ATTCATATTATGTTTAGTTTCTATATGTGTGCTAATATGTAGTTGCAATGTATATTAGAATTGTAAAGTTTAGAAAAAAAAATTACTCCGCTATATATAG
GGGATTGGCTAGGTCCGGTCAAAACTTAGTTGAGCAAATATACTCCACTAAGGGTTTACTCGGCCGGTTCCTCCACTATTTATTGGGACCGGTTAGAAAT
GCCCTAACTAAGGCAAGACAGGGTGATCGAGTATATACATATAGGTCTGGCTTATATCTACTGCAG
page-top