Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh19g04
Contig Information
Length 783 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh19g04   
Homology (BLAST) Top Hit hypothetical protein OsI_01351 [Oryza sativa Indica Group]
Score 1023
Evalue 2.26657e-109
Total Hit Count 19
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh19g04
AGTTGTTGCACATCCATGTCTCAGTTAGTGAATTATATACACTGATCGGTCAAGAGTGTCTACCATGGCTCAGAATTTTTGGTCCAGTAACTTGCAGCAG
GTCTGTGGCTGTCCCAGCCATCCTCTGCTAAAATTAGGTTTACTCGTGCCGTGAGAGTGTTCACTGCGTCGTCCTCCAACATCTCCAGTGGATTGGTCCG
GGGCTGCCCAACCATGGCATTTTGGTACGACGTTAAGTACTGCAGGCAATCTTTGTAGTAGCCACAGTGGTACAGAAGGGCAGCATAGTCCCTAAGCTCA
CAGGGATTGTGATTCAGTAGGATCAATCTCTCGCAAGCTGCCAAAGCACGACGCATATCACCAAAGCGCACATTAGTCCATACTCCACGCATCAACCTAT
GTTGAGCAGATTTAGCAGCAGCCATCTCTATGGCACTTATATTGCCATGTGACCTTGCCTGACTGCCGCCTACATTACCAGGGCCATGGTGGTTTGCAGC
AACAGCATTCAAAAATAAGCTACTTGACTGATTAGACTGGAACGGCCAAAACATACCCTTCAGAGTTTGTAAAATCTCAACCAAAAGTGACTTCGCTGTC
ATAATATTTGGTTCATCACAAAACTTGCTTCTTCGTTTGTCATAGCCCCTAGGGCGGCCATTGAGATCATGTGGAAAGTAGATCTCCTCATCGAAGTCTA
GTAAGCCATATAACCGTAGTGTCTTTAGCATCTCCGAATATATCAACGAAAGCATTAGAGCTGATCCTGATCGGCATGTCAAA
page-top