Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh10p19
Contig Information
Length 714 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh10p19   
Homology (BLAST) Top Hit hypothetical protein OsI_11968 [Oryza sativa Indica Group]
Score 757
Evalue 1.31817e-78
Total Hit Count 475
Registered year 2003
Contig Sequence     [ Download ]
>whvh10p19
TAATCTTTCTGCCCCTACGAAGAGCTTCGACAAGATGCACTCCCCTCACACAGATGTGGGGCTGTTCAGGGTGTCGGGTGTGTTCCCAACCATTTCCAAG
GATGGCGCCAAGCTCGCCTTCGTGGACAACGAGTTCAAAGCCGTGTGGCTCGCCGACACACAAGGCCTGCGCGTCGTCTACGAGAAGCGGGGCTCCAACA
GTGTCTTCTCCACGGCGTGGAACCAGAACCCTGACAAGGACACGTTGTACGTCTGCGTGGGGCCGTCCTTCTCCGCCGCCAAGCCATTGGAGATCTACGC
CATCTCCAACGTGTCTGGGCCGTCCGCCGGCCGGAAGGTGCAGCGCCTCACCGCCGGGAACTTCAACAACGCATTCCCGTCGAGCAACGCGCAGGGGAAC
AAGTTTGTGTTCCGGTCGACGAGGGACGGCGGCAAGGAGAAGTTCCACAAGAATCTCTACATCATGGAGGACGCTGAGGAGGGGGAGTTCGGCCAGGGCA
CGGTGACACGGCTCACCAACGGGCCATGGACCGACACCCACTGCAGTTGGTCGCCCAAGGGGGACTGGATCGTCTTCTCCTCCACGCGCGAGATGCCGGC
CAGCGCGCCGGANATGGCCTTCCTCGACGCGGGCTACTTCNCCGTGTACCTGGTGAAGGTCANCGACCCCACNGTGGTGGTGCNCNTGNTGCAAANCTCN
NCTACCCTCNCANG
page-top