Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh20n02
Contig Information
Length 785 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh20n02   
Homology (BLAST) Top Hit hypothetical protein OsJ_000199 [Oryza sativa (japonica cultivar-group)]
Score 663
Evalue 1.26805e-67
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh20n02
AAAATTGATCTCAGTTATTAACAACCAGCTGCAGGGTAGCAAACACAGAAAAAATATAACCACTCCAGGGAGCACACAGACAAAATATCACAACACACCA
TCACCCCCTGTATTCTCAGCACCCCACAAAACCAGACGATGCGTGGGAAGGAAACGATGACAGTAGGGTTCTTTCTTCCTGGAGCACACGAAAGAATCAC
ATCACACAGAAAAAAAAAACACAGGCTANAAAGCGCCGCCACCGCGGCCTGCGGGAAACAGGGAAACAGCGGCCGACCATAGCGATGTTTATTTTGATAG
GCGGCCATGCTAACTGATGAATGGGGATGAGCCTGAGCGCCTACTGCTGCGCCAGTTTCCANACACGGATGCACGCGTCCTCGCCGGCGGTCACCAAAGT
GTCGTTGTCGGCGAAGGANATCCCGTGGACCCCGCCGAGGTGAGCTCCCTTGATGGTGGTGCGGCTGGCCGCTGGCTTGTCTACGTCGTATATGATCGCG
CAGGTGTCCAGCGAGCCCGTGGCGACNAAACGGCTGTCGGGTGACCAGGCCAGGCAGTTTACCCGAGCTGTGTGGAACAGCATGTTCTTCAGCTTCACCT
CTCTAGTTGCCCGATCCCATGCAACAGCTTCCCTGTTGGAATCAGCANAACAAAACATGGAAACATCCGGCGAATAATGTATGGTAGTAATAGGACCCCG
GTGTTTTTCAAGTACCGCTTCTTCTGTAACAGTATCCCCACTGATGGAATANATCCGCAGTTTCCCGTCTTGAGCACCAACGATA
page-top