Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh10o14
Contig Information
Length 844 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh10o14   
Homology (BLAST) Top Hit putative polyprotein [Oryza sativa (japonica cultivar-group)]
Score 88
Evalue 0.685199
Total Hit Count 5
Registered year 2003
Contig Sequence     [ Download ]
>whvh10o14
TGTAGTGCTCTGTCCTCTCCCTCTCTACTCTCTCATTTGTGCCATGATTCGGGCTAGGGTTAGGTTTACTGAAATTTTGTTGTCCATTGTAGTTTGGATG
ATGCTGTTTGGGATGTTAGGATTCACTTCGATGCTCACCATAATTTGGATAGGAAGATATGCAACTCAGATGTCACATATTTGAATTTGTATGCACTGAT
GCGAACACAAGGATTTAACTTCAGTGATGAATTGTACCACATGGGGAATACATGCATAGGAGTGCAGAGAGAGCATGCCCTAGATTTGATAGACACAAAC
ATCAAGTTGCAGCAAATTAAGAAGCAGAATGAGGACAGTTTAGTTTTGAACTTGTTAGTCAGGGCCACATCATTTGTCAGTACTGCATATCATGTTAGTG
AGCAAAAATTAGCCACAGTTTTATATGAAGAACATGTTGTGTATGATCTGAGAGATCCTCCTGTGCTTGCTGTTAATGATCATGGTGTTGTTTATGAGAG
TCAAAGCAGCAACAGTAGTGCAGTAGTACAACCTGCTGGTATGTGCACACAAGAGAGAAGAAATGTCAGCAAGAGGAAGCTCAAATCTGTGATGGAAGAA
GAGGAAGAGGAGGGATATAAGAGTACTGATGACTCTCAAGGGGCATATGACAGTGACAACAACCCTTTCTGCATGAAGAAGTACAGGATTGTTGAAGACA
CAGAGATAATAGAGGGAAAGAGGCTAGCAGATGCAGAACTAGAAGAGGATGCAGATTCAGATGAAGAAACAGATGAAGATTCAGATAAGGAACAGCTACA
CTATGAGGGTGACACTGAGGTTGAGGAGTTGTTTGATATTGNNG
page-top