Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh10n24
Contig Information
Length 812 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh10n24   
Homology (BLAST) Top Hit hypothetical protein OsI_08135 [Oryza sativa Indica Group]
Score 973
Evalue 1.51587e-103
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whvh10n24
CTTAATACTGTATCATTAGAGCTTTATGTGCCTAAAACCTCCACGGCCATCCACTAACTGGAAGCGGGTCCTAAGTGAGATACGACGTGGACCCTGTTAT
AGTTCTTTACTTTGGAATTTGACATGATTTTTGGAGGCAACTTCACTCAGCAGACCAAAGAGGCCCAGCATTCTCTTTATTTTTTGTGACATCGATTTTT
TTCAAATTCTGTTGCAGATTAGTACCCACTTCATTTTTGATATATGACAGGCTGACGGTTTTATAGTGAAGCATATAACGTTGCTGGCTAATCCTAATCA
AGTGAGGCCAACAAGGTTTTGGGGTGTGTATACCAAATTGAAAATATTCAACATGACTACCTACAGAAAAGTTGTTTATCTCGACGCAGACACCGTTGTG
GTGAAAAGTATCGAGGATCTTTTCAACTGTGGAAAGTTCTGTGCAAACTTGAAACATTCTGAGAGAATGAATTCTGGAGTAATGGTTGTTGAGCCATCTG
AAACTCTTTTCAAGGATATGATGAACAAAGTTGACAGCTTACCTTCTTACACGGGAGGAGATCAAGGTTTTCTCAATTCGTATTATGCTGAGTTCGCCAA
TTCCCGTGTTTATGATCCCAATAAACCTTTAACACCTGAACCTGAGACGCAACGCCTCTCCACATTGTACAATGCTGATGTCGGCCTTTACTTGCTTGCG
AATAAGTGGATGGTCGATGAGAAAGAACTTAGGGTTATTCACTACACACTTGGACCTCTTAAGCCGTGGGACTGGTGGACAGCTTGGCTTGTTAAACCTG
TAGCTGTATGGC
page-top