Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh11a11
Contig Information
Length 675 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh11a11   
Homology (BLAST) Top Hit caffeic acid 3-O-methyltransferase [Triticum aestivum]
Score 986
Evalue 3.27911e-105
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whvh11a11
TCGCTCGCTCACGCTCAACGCACGTACCCGCAGCTCGGCTCCGGAGAGGCAGAAGCTAGCAGAGATGGGCTCCATCGCCGCCGGCGCCGATGAGGATGCG
TGCATGTACGCTCTCCAGCTCGTCTCGTCGTCCATCCTCCCGATGACGCTGAAGAACGCCATCGAGCTGGGACTCCTCGAGACTCTGATGTCTGCCGGCG
GCAAGTTCTTGACTCCCGCCGAGGTGGCTGCCAAGCTCCCGTCCGCAGCGAATCCGGAAGCGCCGGACATGGTGGACCGTATGCTCCGTCTGCTGGCCTC
GTACAACGTGGTGTCGTGCAGGACGGAGGAGGGCAAGGACGGCCGTCTCTCCAGGCGGTATGGTGCTGCGCCCGTGTGCAAGTACCTCACCCCCAACGAG
GACGGCGTCTCGATGTCAGCGCTCGCGCTCATGAACCAGGACAAGGTCCTCATGGAGAGCTGGTACTATCTCAAGGATGCGGTCCTCGACGGTGGCATCC
CATTCAACAAGGCATACGGGATGTCGGCGTTCGAGTACCACGGCACGGACCCGCGCTTCAACCGCGTCTTCAACGAAGGGATGAANAACCATTCCATCAT
CATCACCAANAANCTCCTCNAACTCTACAAGGGCTTCNAGGGCCTCAACACCCTCNTCGACGTGGGCGGNGNCNT
page-top