Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh20o02
Contig Information
Length 775 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh20o02   
Homology (BLAST) Top Hit hypothetical protein OsI_11499 [Oryza sativa Indica Group]
Score 565
Evalue 2.86197e-56
Total Hit Count 425
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh20o02
ATCGCAATATCGTGCATGTTACAAACACAGNTGNAGGTTTCAAACACAAAGGTGAACTATTAAAGTTCNATACNATATATGATATACAATACATATCAAA
GATATACTGTGTGTGAAGATGCNNTGATGTGCTTCATAACACCNNAGTTGTAAATTATTACCCCCAAAGCCACAAGNATAGTAAAACAATTTGAAATAAC
TCACNGTTTCCGTGTCNAGGATGATTACNATGGGGGTACNTCAGGGAACTTGACAAACNNCCCTAGTCAGCCATTTTGTTCAATCGATGANTCATACTCC
TGGCAAGACGATTCCCGGGGNCAATCTTCNGANNCAAACGCNGGTCCTCAGCCCCAAGCCTATATTTCTCACTGCTCTCNTATAAGAGAGCACGTTGCAC
TAGCACCGACACATTGTCCTTATCTTGCTCGAGCACCTTCGAACAGTCGGCAATAGCCTTCTTGTACTCGCCGACCTCCTTATAGGACGAGGCCCTTGAT
GACAACNCCTCTGCAATACCAGCATTTTTCCCAGTCTTCTCNATGAGCAGAACAGCCCAAGACAACCATTTGATAGCATCAGCNTACTGCCCACCCTTGT
AATTANCCNTTCCTTTTGCCTTAGCANCANATGCCGTCAACCCANAGGGTGGTGGCGGNAATCCCTCCNGCTCTGTGGNTGNGCCACTGCTATCANCNCC
ACCNANATACTCCGACTCCACGTCCACCCAACCATCCATCTCACCAAANATGTCNCCACCACCATTACTCNCCGC
page-top