Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh10n09
Contig Information
Length 158 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh10n09   
Homology (BLAST) Top Hit 23.7kDa heat-shock protein [Triticum turgidum subsp. dicoccoides]
Score 180
Evalue 4.0574e-12
Total Hit Count 14
Registered year 2003
Contig Sequence     [ Download ]
>whvh10n09
GAGGGAAGGAAGAGAGAGAGAGAGAAGAGAGAGACCATGGCTTCCGCCGTCGCTTGCAAGGGCAAGGTTCCCGTGCCGGCCAGCCTCCTCAAGTCCGGTG
CTCCCGTGGCCTTCTGCGCGCTCNAGTCCCCCGCCGTCACCGCCGCCCGCCGCNCGTA
page-top