Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh20k24
Contig Information
Length 581 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh20k24   
Homology (BLAST) Top Hit NADP-thioredoxin reductase C precursor [Hordeum vulgare]
Score 890
Evalue 3.10037e-94
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh20k24
TCGACTCGATGAACTCCCGGTATTCCTTCTTCATCTTCACACCANAGAAAGTNCTGATCATTTCTTTGTTTTTGAAGAACTGGACACACGGTGTTCCCAT
TATGCCTGCAGCTTCTGCTATTTCAGGGTCCTCCTCGATGTCAATTTCAACNAAATGAACGTATTCGTCGNATTCATCTATAACCTTGTTCAAAATTGGT
TTTAAGGTTCTGCAGGGACCACATGTTGGAGAAGTATATAGAACCAAAATGAGCCTTGGACTTCCATGGTATAACTTGCGGAGTGCATACTGTCCCTTGT
GCTTTGTGTGAGTAATGTCGAAGCCCATCTCGACATCTTTGCCTTCAATCTCCTTCTTTTTTTCTTCACGAACAGGCTGGTGAAATTCAACAAGAAGATC
ATTGGAGACTAAGTATCTTTCAACTGACAAAGCAGCTATACATCCAGATCCAGCTGCAGTAACGGCTTGCCTCCATTCATGATCCTGCACATCACCAGCA
GCAAATACGCCATCAACTGAAGTTTTTGCTGTCCCTTCATCAACCAAAATATATCCAGAACTATCAAGTTCAATTTGACCT
page-top