Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh17p17
Contig Information
Length 599 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh17p17   
Homology (BLAST) Top Hit pre-mRNA processing splicing factor 8 [Pyrenophora tritici-repentis Pt-1C-BFP] >gi|187976743|gb|EDU43369.1| pre-mRNA processing splicing factor 8 [Pyrenophora tritici-repentis Pt-1C-BFP]
Score 81
Evalue 2.18107
Total Hit Count 35
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh17p17
AGCGGAAATGTANTAATAGATANAACATGCATAGATTAACATATGAGACCATACGGCATCACGAACTCATGTGGAAGACGGATATTAACCCTAAAGTAAA
AAATAGGAAATAAACAGAAAATCCCTACGAATTCACTAAAGCTTAACCAATCTACCAACGCAGATATATAAGCTTATACACCAAGCCAGAGACTCAAACA
GACATATTTTCTTCATCAAAGAGATACCAGCGAGCAAATAGGTTCATGCACATCTAGACTATCAATTTTCTCACGGATTTGCATATAGTTGTTGGGCATG
CTATCAGAACGAAACCTATCTTCGGGTCAAACCAATCTACAATCTTAGGCCTACAGATCAGGCAGTAGACGCGTCTAGAGATAATTTTATATGGTATAAA
AGCTACTTGGGCGAATCTATCAAGCAGGAAGACGAACTAGTACATAAACATGCATAGATTAACAAACGGGACCACATGTCATCAAGGAATTCATCCTGAT
CAACCCATTCAATACGCGAAATCCCTACGAATTCGCTAAATCTTCACCGATCTAACAACAGATCGGGAGCCCAATTCCACAGTACCACACGTCCAACGA
page-top