Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh18a17
Contig Information
Length 869 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh18a17   
Homology (BLAST) Top Hit GJ14785 [Drosophila virilis] >gi|194147215|gb|EDW62930.1| GJ14785 [Drosophila virilis]
Score 79
Evalue 7.89651
Total Hit Count 3
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh18a17
ACTTGTATTGAACGAGTGATACATGCCATCTTGGTTCTAAAGATCATTGATAAAGAATACTGAAATCGTCTCCACAAAAAGAAGGGGAGAACAGTGATCG
TGGATGGAGTGGCCGATCTTCATCTCAAGCTCAACGCATCCACTGTCCCAGATGCTGGGCCAGTCTTCGTCGTCGTCGTCACCGTTGGTAACCACTGTAT
TTGGCCGCAGCGGATCCCACAATGGTGCTCCTCCTGGATCCAACTGACGCTGCTCTCCTGGCCCTGCTACGAGGAGGCTACAAAATCAGCAAGTTTCAGT
GCTTCTGTGGAACCTACTGTCCCAACAATTTATCCTCATGTCGGATCCATAACAGGGAGGAGAGACGAGAGGCAAGTTGTACCTGAGGTGTTCATGTGAC
CAAGGGCATGCACGAACGAATCGATGAAGAACCCAAGGCTCACACAACGTCTCTGCTGCTCCTGCAGCATGCGTCCATTTCATCATCGTTCTTCACGATG
TCGAAGACGAGGAGGAGAGAGGTGGCTGCTTGGCCAGCAAGCCAACCACAACACCCTTCATCGACCCGGCTCGACCTCGTCCTCCTCCACATCCTCGTCG
GCGGCACCTTCCCCTCACTACTGGACTGATAACATCAGGATGCGATACTGCAAGTAGACTCGCATGCCCAACTTCACTACCCTCATACATATTCGAACTT
GGTCTTCAAGCAGTTTCACTTGTAGGTGGCCAGAGATTTGCATCAATGTCATATGTTCAACAATCTCTCCAGCGACTGAAATATTCTTATCTATGGGCTG
GAAGCAACAAAGTATATCCAACAATCTCTCCAGCAACTAAAATGCAAAGACATGAACCAGAAAACCAAT
page-top