Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh10m22
Contig Information
Length 690 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh10m22   
Homology (BLAST) Top Hit RecName: Full=Plasma membrane ATPase; AltName: Full=Proton pump >gi|45268533|gb|AAS55889.1| plasma membrane H+-ATPase [Triticum aestivum]
Score 632
Evalue 3.86286e-64
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whvh10m22
TCCTCCCCACCCACCACCACTCTCCCCCCCTCCCTTCTTTCTCCGGAGCGGAGGAGAGAGCAGCGGCCAGCGCGGCCTCCGTGCTGGTGCGTGCTAGAGC
CGGGCCTCGGGGTTCGCCTGTGGACTCCGCCTGCTCCCTTCCCGTGCTGGTTCGGCCCCCGACCGCCACCCGCCGCCAGCCATGGGCGGGCTCGAGGAGA
TCAGGAACGAGGCCGTCGATCTGGAGAACATCCCCATCGAGGAGGTGTTCGAGCAGCTGAAATGCACGCGCCAGGGGCTCACCTCCGATGAGGGGGCGCA
GCGTGTTGAAATCTTCGGNCTCAACAAGCTCGAAGAGAAGAAGGAGAGCAAAGTCCTCAAGTTCCTGGGATTCATGTGGAACCCCCTCTCCTGGGTCATG
GAGATGGCCGCCATCATGGCCATTGCGCTGGCCAACGGTGGTGGGAAGCCCCCGGATTGGCAGGATTTCGTTGGAATCATCGTTCTCCTGGTCATCAACT
CCACCATCTCCTTCATTGAAGAGAACAACGCCGGNAACGCCGCTGCTGCGCTCATGGCCAANCTTGCGCCCAAGACAAAGGTGCTTATGGATGGTCGATG
GGGCGAGCAGGAGGCATCAATCTTGGTTCCTGGTGACATTGTCAGCATCAAGCTCGGTGACATCGTGCCTGCTGATGCTCGNCTCCTCGA
page-top