Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh20g24
Contig Information
Length 508 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh20g24   
Homology (BLAST) Top Hit hypothetical protein OsI_17116 [Oryza sativa Indica Group]
Score 264
Evalue 8.06864e-22
Total Hit Count 23
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh20g24
AGAGTATCATCGAATCCGATATGAATGCAGAATTATTGAGCTATACAGCTTATCCGAGAATTCTGGAATCAGATCATTTTGGTGGTACAATGGTGCCATT
TTCTACAATACATTTACAGTGTCAATTTCTTCATGAGCATCGAGGCAAGCAAATATTTACCTATTTTGCTTCAAATTTACAGACACCCAATCCCCTTGCT
CCGATGCTGAAGATGAGCATCAGGCACTCGTCGAGTTTGGCATCAGGTTTTCTCCTCCACGGAATTGAAGTAATCCTGGAGCCACCTGACATGAACCTCC
AGCCCGGCTTCTCGGAGGCTGTTGAGGACGATCATGTACAGCCTCCTGTCCAGCTTGGTGTCCTGCAGCTTCATGTCCCTCAGCAGCTGGATGAGCTCGT
TGAACCGGCTGGTCTTGCAGAACACCCCCACCATGAGGCCGGCCAGGGTCTTGTCCACCGTCCCTCCCGTCTCCTCTCTCTCTCTCTCTCTCTCTCTCTC
TCTCTNTC
page-top