Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh10n16
Contig Information
Length 711 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh10n16   
Homology (BLAST) Top Hit Os04g0526300 [Oryza sativa (japonica cultivar-group)] >gi|38344441|emb|CAE05647.2| OSJNBa0038O10.13 [Oryza sativa (japonica cultivar-group)] >gi|113564933|dbj|BAF15276.1| Os04g0526300 [Oryza sativa (japonica cultivar-group)] >gi|116310962|emb|CAH67898.1| OSIGBa0115K01-H0319F09.4 [Oryza sativa (indica cultivar-group)] >gi|125549090|gb|EAY94912.1| hypothetical protein OsI_16714 [Oryza sativa Indica Group]
Score 780
Evalue 2.83771e-81
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whvh10n16
GCTTGGGCTGTCTGCCGTACAATGTCTTCTTCCTCCTCCATCCCAACCTTTCCGCCGCAAGAGGGCGATGCCGAAACCAACGAGGAGCTCTACGGGCAGT
TCACCGAGCTGGTGTCCTCCTGGCCGTGCTCCCGAGGCCTCTCCAGGGCGAACCAGCTCTACCGCCACGAGAAGGGATGGTACAGCACCCTGCCTCCGAT
GGTCGGCGCGATGGTCGCCGACGCACGCTTCGCCGCGCGCCCCTCGGACATCGTCGTCGCCACCATGCCCAAGTCCGGCACGACGTGGATGAAGGCGCTC
CTCTACTCCACGGTCAACCGGAAGGAGCACCCCCCGGGCGGCCCCGGCCACCCGTTCAACTCCCTCGGCCCGCACGAGTGCATCCGCCACCTGGAGTACC
AGCTCTACACGCGCAACAGGGTCCCGGACCTCGACGGGCTCCCAGACCCGAGGCTCCTCGCCACGCACGTCCCGCTCGCGTCGCTGCCGAGGTCCGTCGC
CGCGTCGGCGTGCAGGATCGTGTACGTGTGCCGCGACCCCAAGGACACCCTGGTCTCGACGTGGACCTTCGTGAACAAGTTCAGGGCCGAGGACGGGCTG
GAGCCGATCTCGGTCGAGACCGCCGCCGACTACTTCTGCGACGGCGTGTCGGCGTCCGGGCCGTACTGGGACCACGCCCTCNGGTACTGGCNCGCNCACC
TGGNNAACCCC
page-top