Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh18b07
Contig Information
Length 897 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh18b07   
Homology (BLAST) Top Hit hypothetical protein OsJ_015592 [Oryza sativa (japonica cultivar-group)]
Score 1004
Evalue 4.5927e-107
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh18b07
ACCTGGAAGCAAGACTACCGACTGCTCCCTTAGGAGTAGAGATAACAAAGGGGAATAATCACTGCCAGCAGTAGCGAGCATTCTGAAATCTGAACCATAT
CAACAAGTCGCAGAAACCTCGACTAATCACTCAGCTAAGATGCGCAATGTCGACCTCATCAGGTAACTTGAAGGTATCCGCAGCCCCAAACTTCTTCCTC
CCCTCCTTCCACTCGTCCTCATCCTCCAGGCTGTCGCTGTCGTCGTTCTCGTGCCCATGGCTTGATGGAGTCGCGGGCTCCTCGACGCTCTTCGACTTGC
AGTGGCCGTTGGCGAGCATGGTGACCTGACGGAGGTGGGAGATCTCGACGACGACAGTCTCGTCGTTGCTGGGGAGTGGCTGCTTCCATGGCTCACCGTC
GACCCTCATGAACGTGTGGTCGGCTGCTCCTTTGTGGAACTCGAACCGGATTCTATGAGCCTGTGCTAGACGAGTCCCGTGTCCATTAGGGGCCANCAAT
ACGAGACCGTGCCAAGCATCACNAAAGCCGACAACCTCAATGAGTCCATCATCAACATAAGGCGCAGTCAGGTCCCTGTCTTGTTTCTTCCTCGTGCCAG
GGGTTCCCCAGGGATTGAATCCTCCCGAAAAACTTGGCAAATTGAGGCAGATAATTGATCGAATACTGCTCGGGATTTTAAGCTCTTCCCATTTGCCACC
AATTTTCATGATCTTCACCTTTGCAAGTTGCGAAATGTTCCTTGAAGAGGAATGGGTTAGGGAAGGAGCAAACCATCCTTGTTTAAGTCCAGCTTAGCAT
ATGTACCCTGATTCGTTAGCTGGGTTTTTGAACTTCTCTGGATTTTTCTTCCTTTCAGAGTGGAACCCATATGANACTTGANCATCCATTCCCATAC
page-top