Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh18c23
Contig Information
Length 106 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh18c23   
Homology (BLAST) Top Hit hypothetical protein OsJ_020886 [Oryza sativa (japonica cultivar-group)]
Score 69
Evalue 0.00820625
Total Hit Count 214
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh18c23
AGCCTCCTCTNCCACAACTGCTTTCATGGCCTGGACATCCTTTCCAATGGTCATANTTGGCATAAAGCTGGTTAGACACATCTGAATGGTCTCGCCCGGC
ACGAGG
page-top