Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh18e12
Contig Information
Length 707 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh18e12   
Homology (BLAST) Top Hit acyl-peptide hydrolase-like [Zea mays] (no hit)
Score 1045
Evalue 4.67684e-112
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh18e12
AACCCCATTTTTGTAGGTTCTACTTACTTTTCATTGGCTTCGGAATAATAGAGTAATTCGGAATAGCAGCCAAAATCTTGGGAAAATCTAAGTTAATGAT
CAATAGGTTTGGATAAATAATTTAGGAAGGATATTCTCATACTGACACAATACAAGGACAAGTATATGTGAAATCTATCCTTTCATAATTCGTAATTAAT
CCTTGTATTGTTTGTTGGATTAGGTCTAACTTTCTTGACCAAACTGCGAGCGCGGAACTTTACGAGATGAAATAGGGAAAGACAGAAGATAGAATAGAAC
TTAAAAGGATAATTGAAGTGACTTGTCTTCGAATCTACTTTGGTTGGAGTTCGAAAAAGGAATAAAAATAAAGTAAATTCAAGGAAGAGCTTTCTTTTTT
TTTTTAACAGCCCCTTGGCAGGNCGGGGAANGCTTTTGTNCNCCNCTTATNCCATANGGAATACAATCAGTTAAAATAANAAGGAATAGGGGAATATTCG
ANCGTNCCCNCCAAAAAGAGGGNCCTATTGAAAAAGAAATTANCCAAAATANAAAGAAGTTTTTTTTTTCCAATCCAATGGTTNATTTANCCCTNATCCA
AAANTTCCCTNGAAAANCNANTTNCTTTTTTNCCCCNGCNCCCCGGGGGANCCCCTANTNCTAAAGNGGCCNCCCCCNCGGGGGANCCCCNNCTTTNGTC
CCCTTNA
page-top