Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh20j15
Contig Information
Length 881 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh20j15   
Homology (BLAST) Top Hit acyl-peptide hydrolase-like [Zea mays]
Score 1045
Evalue 4.67684e-112
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh20j15
ATATGGATTTGGCGTTCATGACTATAATCATGACTGTATGATGGCCTATAGGAGATCTGCCCGTTCATCAATGGTGTTATAGCAGTCTCTGCTGTTCGGC
ACCATTACATCTACACCATCTGTGAAAGGCGAACTTCTAGAAACAAAGGTGAACCGATGATACGCTTGTTACTTGCAGCCATCAGTCAAAGTTCTCAATC
TTGATCGGAGTTATATCATCTGCCACCTCAAATTTCCCGACCGTTCGAGCAAAAAACACCATCTGCTGCTCCAAGGTGAACTTGATGTTTTCGGCCTTGC
GGAACCCATGCTGCTCCCCTTCGTATTCAACCAAAGCAACAGGCAGACCACTTTCTTTCAAGGCCTTGTATATTTTACGCGCCTGGTCTGGTGGCACGAC
CTTATCATCCAACCCTTGAAACAGAATAACTGGGCATGTAAATTTATTGACAAAGTTGATTGGTGATCTTTCATAGTAAGCTCCTTCACTTCCAACAAGA
TTGTCCATATAACGGGACTCAAATTTGTGTGTCTCTGCCCTCAGCAAAGTTATATCACCAATACCATACAAAGATGCTCCAGCCTTGAATGTATCTCTGA
ATGCGAGTGAAGCTAAAGTAGTGTATCCGCCTGCTGATCTCCCAGTTATACAAAGGCGCTGTTCATCTACTTTCCCATTCTCCACCAGGAATCTTGCACA
GCTGCAACAATCATCAACATCAACAATACCCCATTTCTTTAATAATCTCTCTCGATACTCTCTCCCATAACCGGTGCTTCCTCCGTAGTTAACATCAAGA
AATGCCCACCCTCGACTTGTCCCAATACTGGNACACTAAGGTCTAAAATTCCCACGTGTTTTCAGCTGTAGGTCCTCCATG
page-top