Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh20b06
Contig Information
Length 847 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh20b06   
Homology (BLAST) Top Hit vacuolar proton-ATPase subunit A [Triticum aestivum]
Score 974
Evalue 1.26232e-103
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh20b06
GTCCACCGGTGGTTCAATCTTCTTATACAACAAATAATGGTACACATGGTGAAAAAATAATGGCGTGCATCCTGGCGCTGGAGACCAAACAATGTAAAAA
TCCTGGAAAAACAAGTCTGTCTGTCTGTCGCAAAAAAAAGGGGGGAGGGGATCCTGAAACGTAATTCGCATCTACACAAACTCCGGTGAAGCAAAAGCAA
ATTGCTCGCAAGTCGTTCACAGCATTTGGTGCTCCTTATTGTTTACACGGTGGCCATACACAATGTTTCCTCTTTCTCTTTTTTACCTAGCCTCGTCTTC
TAGGTTGCGGAACCCGGTGGTGAGGTCGTCGTACAACTTCTGGAATTTTGCGATTAGGACGTCTTCGCCTTCTGCGGGGTCTTCGAACTTTTGGGATACA
AGGCGGTAAAATAGATCGCCCATGCGACTCTTTACGACGGCGTAGGTTATCTTGTGTCCATCAGCATTGGCTGCTCGCTCCACGGCCTGATTCGCTAATG
TATTGAAATGAATAATGTTGCGCATCATCCAGACAGATTTGTAGAATGGACAATACTTGTCATATGGGGTAAAAGCATTCTGTGCCAAATAATCTTCCCT
CAGAAGCTTGGCTGTCTCCAAAGTAATCTTGTCAGATTCTCCCAGTGCATCTTTACCAACAAGCTGGACAATTTCGTTTAGGTCATCCTCTCTCTGCAAC
ACTTCACGAGCTTTTGTTCTCATGTCAATAAAGCCAGGATCAAACTTTTCATAGTATCCTTCCAAAGCCGTGGAGTATTTTGAGTAAGAAATGAGCCAAT
TAACAGATGGGAAATGCTTTCTTTGAGCCAGCTTCTTATCCAGTCCC
page-top