Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh18e18
Contig Information
Length 865 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh18e18   
Homology (BLAST) Top Hit 6-phosphofructokinase 2 [Zea mays]
Score 1129
Evalue 1.38091e-121
Total Hit Count 243
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh18e18
AAGATTGCCATCGTGGAACCCTTATTATATATAGTTATACAGTAATTCTCCGGAGAAGTCTCTACTACAAGGCAAGCTAAAAAACTCACAAGAGAAGGTT
AAAAAAGAATAGCTATAATTACACATGCTCAATATATCCATCCCAACAGCTTTGTGCCTCTCACTCTGCTCCAGCTGACCCGTTACAGTTGGGTGAGCAC
TTCGCCCGTGAGCCATCGAGGAGCTGCGTGTTGTGCAGGTGGTGGCGCTCGTCGTCATCGTGCTTCATGTTCTCGACATCCTCGTGGCTCAGGAAGCAGG
GCTGGTTCGTCGAGCACAGCACCCTCGCCCACATCCTGTCAGTGATCACGACCTTGTTCTGCTTCTCAGTGATTCTATAGAATGGGATGTAAGCATGTCT
GCCGTTCACGGGCGCGACGGTGAAGCCACTGTATCCTGCCATGGCGCCATGGAGGGCGCTGTGCGCAAGCAGGGTGCAGTAGACGTTGTCAGAGGCGTTT
GACCGGACCGCGCGGATCATGTATGTCGGGTCAATGTACTTGAGAGTTATGGGGAAGTTGGTCTTCTTCTTGAAATGATCCTTGATCTTCTGGGATAGCC
AAAGGCCAACATCCAGAAGCAGCTTATTTCCAGAAGCATCCTGAGTGTCCACAAAGTTCATGCTTTGGGCGATGAGATCTTGGCCAGCACCCTCGGCCAC
CACAATGACCATATGACCACTATCCTTGAGCCGTTTCTCGACGAACTCAAGGAGGCCTCCTTTCCCTTCAAGGTAGAATGGAGACTCTGGGATTAAGCAA
CAATCCACATCACGACTAGCTAGAGTAGCATACATTGCGATGAACCCACTGTTGCGGGCCCATTA
page-top