Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh10l15
Contig Information
Length 781 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh10l15   
Homology (BLAST) Top Hit Os04g0595300 [Oryza sativa (japonica cultivar-group)] >gi|113565304|dbj|BAF15647.1| Os04g0595300 [Oryza sativa (japonica cultivar-group)] >gi|215713566|dbj|BAG94703.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1098
Evalue 4.55641e-118
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whvh10l15
GCTAGCTGATCAGGAGTCCGGGGTGCTGAGCCAACTAAACCTTGCAATAGTGGGTCATGTTGATTCTGGCAAGTCAACACTCTCTGGGAGATTGCTACAC
CTATTAGGGAAGATATCGAAAAGAGATATGCACAAAAATGAGAAGGAGGCTAAGGAAAAAGGAAAGGGGTCATTTGCTTATGCATGGGCCATGGATGAGA
GTACTGAAGAAAGAGCAAGAGGTATCACAATGACAGTGGCTGTCGCCTATTTGGAGACCAAGAAATACCGTGTAGTTTTGCTTGACTCTCCTGGCCACAA
AGATTTCGTGCCAAATTTGATATCTGGTGCAACACAGGCTGATGCAGCTATTCTTGTGGTTGATGCATCAACTGGTTCTTTTGAATCTGGTATGGATGGG
GAAGGAGGGAAAAGTGTTGGGCAGACAAAGGAGCATGCTCAGCTTATTAGAAGCTTTGGTGTTGAGCAACTTATTGTTGCAGTCAACAAGATGGATGCTA
TTGGGTACTCAAAAGATAGGTTGGAGTTCATCAAGGTACGACTTGGTAGTTTTCTGCGGTCATGCAACTTCCGGGATTCAGCTGTTACCTGGATTCCTCT
TANTGCTGTANAGAACCANAATTTGATTAAATCTCCTTCANATGCTCGTTTTACCTCCTGGTATCAAGGGTCGTGTCTCTTGGATGCTATANATTCCTTG
CANCTTCCTTCTCGGGATGTTTCAAAGCCCCTCATTCTTCCTATATGTGATGTTATCANATCTCANTCNACANGACAACTG
page-top