Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh20e10
Contig Information
Length 806 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh20e10   
Homology (BLAST) Top Hit hypothetical protein OsI_37726 [Oryza sativa Indica Group]
Score 722
Evalue 1.90277e-74
Total Hit Count 87
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh20e10
AACTGCACAGTTATGAACACCAGCAACTAGTAGCCAACAACGGTAGCTAAAGATCAGAGGCAGAAGTAGCAAGCAAGAGCGGACACGGTACAATTACTGG
GATCCCTGCTAACACCAAGCAGCCACAGATAATGCGAACCTAGCGATCTGAAAGATTTCCTTTACTCTCTCACTGAAGGACAAGGCAACCTTCCGACATG
TGTGAAGAGGCTCGTGGGACGGAGGATGACGATGCATAAGGAGACTCACTGGATTCCTCTTCCTCGTCAGATTCAGTGAGGCCGGTGGCCTCAAAGATAC
ATGCCTTCACCTCCTCAAATCGCTCCTCCGACAGAGACACCTCAGCGAGAAGCCTCCAGGCTGATGCTTCTGAAGCCTCCTCGAAGTCCGTCCTCCGTTT
CAGAACAATGTGGCCACTGATCTCCCATACTGCAGGGTTCACCTGCGTGTCTAGCAGATCCTGGCTCACTTCACCGAGAGCCTGCTTCTCGGCATAGCAC
TGAGGAAAAACGAAGATCCTTCTACCGGAATCAGAGATGAGGACGTTGAAAGGAACATTGTTCTCCTGGAGCCAAATGCAAGCGTTGGTAACCACATCAG
CCAAATCCTTCAGTGTGTTCCCTCTCTCAAACACCAGACCTCTCACGGGGAAATTTGTCAGTTTTGACACCTTCACTCCACTATTCAGCGCACACTTGGC
AAGGGGGATCTTCTTGGTAGGCGCCTTCTCAACAGGAAAAGGTACTGACAGGTAGTATGCCTGGAAGTGGAGATGCTCTCTCTCTCTCTCTCTCTCTCTC
TCTCNC
page-top