Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh20g01
Contig Information
Length 651 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh20g01   
Homology (BLAST) Top Hit putative LHY protein [Oryza sativa Japonica Group]
Score 389
Evalue 1.12833e-65
Total Hit Count 56
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh20g01
AATCCTCTTGGTACCANCNTCGNCAACNNNCGGCACCCTATTCTCCTTTGCTTCCACCGAGCACCTCTTGTAAGGTTTGAAGCCTGTCCGGCGGGATTTC
ATATTCAGGNGTGACAATTCNATGGGAAAGGTANCANCTCTTGGCCCAACCAATGTATCAAGTTCATGGTCTATAACTGCAGCACTCTTGTTGAGGTCGA
CCGTCACCGTAGTAGCTTCGTCTTGTTCCCCCCTGGGTACCACCTTCAATCCTTCTGCTTGTGGAGGAGAAAAGCTTTGGGGAAGCTTTCCTCTACTGAA
CAGTTTATCGAAAGCCATACGACCCTGCGGTGGTTCATGTCACCAGCTGAAGAATTACTGCAACATGCTTGCTGTGTCTTGTCGTTGGCTTGATCTTGGT
TCTCAGGAACATGTTCTGCCTCTACATCACTACTTGATGGCGTGTTGGAACCACATGAAGAGCGATCCTGCTTCTTCTTGTTGCCGAAAGCATCACTTGT
TTCAGCTCCTGTGGGAGGTGTTGTCTCAACTTTATCANTGTGGGGAGACACCTCTCCTTTTCCACTCTCNTCTGATCCANAANACGCACCAACTATCATA
NCTTCANGTTGACCTTGCTCCTGANCTACTTGGCATTCCCTTCGGNGCGTT
page-top