Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh19l09
Contig Information
Length 869 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh19l09   
Homology (BLAST) Top Hit hypothetical protein OsI_11411 [Oryza sativa Indica Group]
Score 706
Evalue 1.55823e-72
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh19l09
AGCGGCCACCAAAAGATTCCATTTAGATAATTAAGGTGGCTAGGCTCAATAGACTTGCAGATCAGCATCGACACAGGGATGGAACCATTTTTTTACCTAT
TATACGTTGACTGAACTGCTATCATCTGAATTGCCAAACTGATGGTTAACTATCATGCACCCTTTGGCGCTTCTCTTGCGGGGCCTTAGAACCATCATTA
GTATTTGCAAGGGGGTCAGAAGACTCGCTTTCTGCCATCTCCTGGTTGCCACCTGCATGCATGGAAGTTTCTCCTATTTCGGCACTCACGGGGTTCTCTC
CTGTTCTATTTAGGTCATCAGCTGCATCATTATCCCTATCTCTGGTTGCAGGATGGCTCGGTTCAGATAATAGGGTTGTTGTAGCTCCCGAGGATAGATC
CTGCACCTTCTCAGTATTGGATTTAGACTGCTTTTCAAACATCATCTGAAGATACTTCCCTTGTTCTTCAATTCGCAACTGCAGCTTTCTCTGGGTCTCA
AGTTGTTCATGAAGACGTTTCTGAACTTCCATCTGAAGGCGCAGCGCTTCAGTAAGATCCATGCTCGATTTCAGGTCTAGAGTCAACTCTTCGGTGGTAG
TCCTTTTTTCTGCTGTACCTTCCGTTAGGTCTGGCTTATAGCGAGCTGTTCGGTACTTCTGCAGATGGCTTTTCACATGATATATTGTCAAACCGTCAAC
TTTCATAAGCTTCAGCACACCCTTGGGAGTAGCTTTTTCACTACCACCAAGCTTATTTACAGAGTCTACGAAGCACTCATGGAGTTCTGGAGTCCACCTC
ATCCGTTGTTTGGCTGCANAGTTGCCTATTGGGANGGACTANCTACATTGCAAAATCTCTCCACCATGA
page-top