Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh18l04
Contig Information
Length 316 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh18l04   
Homology (BLAST) Top Hit GK25307 [Drosophila willistoni] >gi|194167212|gb|EDW82113.1| GK25307 [Drosophila willistoni]
Score 74
Evalue 7.99233
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh18l04
TTCTGAATGATACGTAAAAGATAAAGCTAACCCGCTGACNTAAATANCAACGTNGCTCACTCACTAACANCAACAAGCCATGGCTAAGATACANAGGAAC
TTTACCAATTTCATCNCTTGGCGGGAGGGTGGTATACCGGACTCAATGGTGTCCGTGGTATCCACCGCCACCACCGCCGCCGATAGGTGGGCGTGGGAGG
GACGGGGTGGTAGTCCGGGTGGGGCTGCGNNTTCNGNTCGGGCTTGGGCANAGGCCCANAATCCGGGTGGGGCTGAGGCTTGTGNTCCAGCTTCNGTGGC
ACNGTGCTTCTTGTGG
page-top