Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh10k16
Contig Information
Length 796 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh10k16   
Homology (BLAST) Top Hit phenylalanine ammonia-lyase [Hordeum vulgare subsp. vulgare]
Score 1307
Evalue 2.75632e-142
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whvh10k16
CGCGGCGAGAGGGCGGCGATGCTCGTCCGAGTCAATACCTTGCTCCAGGGATATTCAGGCATCCGCTTCGAGATCCTGGAGACGGTCGCCACGCTTCTCA
ACGCCAACGTGACACCATGCCTGCCGCTCCGGGGCACGATCACCGCATCCGGTGACCTCGTCCCGCTTTCATACATCGCGGGCCTGGTCACCGGCCGCCC
AAACTCCATGGCGACCGCTCCAGATGGCACCAAGGTTAATGCCGCCGAGGCATTTAAGATTGCCGGCATCCAACATGGGTTCTTCGAGCTGCAACCTAAG
GAAGGCCTAGCCATGGTGAATGGCACGGCAGTGGGCTCAGGGCTTGCATCCATGGTGCTTTTCGAGGCTAACATCCTTAGCCTCCTTGCCGAGGTCCTGT
CAGCCGTCTTCTGCGAGGTGATGAACGGCAAGCCCGAGTACACCGACCACTTGACCCACAAATTGAAGCACCACCCTGGACAGATCGAGGCTGCCGCTAT
CATGGAGCACATCCTTGAAGGCAGCTCCTACATGATGCTCGCGAAGAAGCTCGGTGAGCTTGACCCATTGATGAAGCCAAAGCAAGATAGGTATGCACTC
CGCACATCACCGCAGTGGCTTGGCCCTCANATTGAGGTTATCCGTGCTGCCACCAAGTCGATCGAGCGGGAAATCAACTCCGTCAACGACAACCCACTCA
TCGACGTCTCCCGTGGCAAAGCTATCCACGGTGGTAACTTTCAGGGCACACCCATCGGTGTGTCCATGGACAACACCANGCTTGCCATTGCTGCGA
page-top