Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh10k07
Contig Information
Length 471 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh10k07   
Homology (BLAST) Top Hit unknown [Zea mays] >gi|194703112|gb|ACF85640.1| unknown [Zea mays] >gi|195617538|gb|ACG30599.1| nifU-like N-terminal domain-containing protein [Zea mays] >gi|195639094|gb|ACG39015.1| nifU-like N-terminal domain-containing protein [Zea mays]
Score 223
Evalue 4.17817e-17
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whvh10k07
TCCTCCGCTCGCTACGTGAATGGGTGAAGGGAAAGCAAATGGAGGAAGCTAGCTGAGCTATCANGAACACTGANATTGCAAAGCACTTGTCACTTCCACC
AGTAAAGCTCCATTGCANTATGCTTGCTGANGATGCAATTANAGCTGCCGNGAAAGATTATGAATCAAAGAAGGCGAAGCTGGGAGACAGCCCTGCNNAN
AANGCTGCCGAAGCATGAACATGATATATGCTTCTGTTCTATGANGGTGAGAAATGGTGTGCNATGTTGACANNCTCCAGTGTTGTAGCATGTATCNTAA
GGATGAACACGAACAACTTGAAATAAATGTGATGTCATGTTAGGAGAAGTTGTGCATGTATAGCAGCTGCTAAGAAAATTTGTGCATGTATAGCAACTGC
TTGGAAGTCTTAAAAGTACACTTGATGTCATTTGCCCGTTCTAAAAAATATTCGGTTCTATAAAAAAAAAA
page-top