Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh18m17
Contig Information
Length 794 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh18m17   
Homology (BLAST) Top Hit hypothetical protein OsI_02884 [Oryza sativa Indica Group]
Score 817
Evalue 1.80218e-85
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh18m17
ACCGGTCAAGATTTGGCGTCAAAAATAATACAGTGGCCATGCTGGAAGTGAAGACTTCTGAGCTCGGAGAGAAGCTATGGTTGTCCAAACTCTGACCATC
CTCCGCAGACCAATCTGCAAATCCCCAGTATCAGCAGCACTGAGGTGCATTGTGGTTGGCCCAGTCGTGCGCTCTAGCACATGAGTCCTGCTTTTGCCCT
TGCAGATCAGGCTATGTAGATCGAAAGCCAGGAACTTTGCTAAGACCCATCTTACGAAGAATGAGCTTGGGTATGGCTGGTGGGGCCGCAAGTCCCATGC
TCCGGCTGAACTCTTCGCCGAGAGTAACAAGTCTGGACTTGTTACCACCAATGGTCTTGTTTGAGTTGTAGTACCCTAACCATGCTTGATATGCTGATTC
CTTGCTCTTCATCTCTACTCTTCTGAGTGCACCTTTCACTTCTGTTTGAGTGCTTGAATCAACTGAAGGCGTCACAGCCTCTGATACCGACAGATCTTTC
ACGCTGGTAAGAAAATGGCTTTCCCAGGGAGCCAACAGTAAGAGGCCCTGCCCTTCCTTGCCTTTCCGTCCTGTCCTACCAATTCTATGTATATACTGTT
CTCTACCAGCAGGAATCCCAACCTGTATGACAAGGGTGACATCAGGATAATCAACACCACGGGCAGATACATCAGAACTAACTAATATCACACCCTTTGA
CCTTCTGAATTCATCCGAGACCTTAGTTCTTGCAGATTGTGACTTTCTGGAATGAATCTCTCTTATATTCAGTTTCAGCTGGGAGAGAACTTCA
page-top