Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh18p01
Contig Information
Length 774 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh18p01   
Homology (BLAST) Top Hit beta tubulin 6 [Hordeum vulgare subsp. vulgare]
Score 665
Evalue 6.10038e-95
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh18p01
AAGAAACATAGCATCGAGTGAACATGCCTACAAACGAACGCAGTACAAATCCAATACATGCCAAGACACGCAAACAAGCAGCAGAGTTGTAGCCATGGAT
ACCCTCTAGTCTCTACTAGTAACAAGCTCCAGTTGTACGAAAACCACAATACCACATAAACGGAGAGATGCAATCGTCACCGATCTTACTCCTGCTCCAG
CTCTTCCTCTTCCTCGTACTCGCCCTCCTCGTCGGCAGTGGCGTCCTGGTACTGCTGGTACTCGGAGACAAGGTCGTTCATGTTGCTCTCGGCCTCAGTG
AACTCCATCTCGTCCATCCCCTCGCCAGTGTACCAATGCAAGAAAGCCTTCCTCCTGAACATGGCCGTGAACTGCTCGCTCACACGCCTGACATCTCCTG
GATGGAGGTGGAGTTGCCAATGAAGGTGGACGCCATGGAGAGGCCGCGTGGTGGGATGTCACACACGCTTGACTTGACGTTGTTCGGGATCCACTCCACG
AAGTAGGAGGAGTTCTTGTTCTGCACGTTGATCATCTGCTCGTCAACCTCCTTGGTGCTCATCTTGCCACGGAACATGGCCGAGGCTGTGAGGTAGCGGC
CATGGCGCGGGTCAGCAGCACACATCATGTTCTTCGAGTCCCACATCTGCTGTGTGAGCTCAGGGACAGTGAGGGAGCGGTACATCTGTGACCCACGAGA
TGTGAGCGGCGCAAAGCCCACCATGAAGAAGTGGAGGCGCGGGAAGGGGATCAGGTTGACGGCGAGCTTGCGGA
page-top