Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh19n07
Contig Information
Length 136 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh19n07   
Homology (BLAST) Top Hit fb14 [Zea mays] >gi|195617800|gb|ACG30730.1| fb14 [Zea mays] >gi|195620890|gb|ACG32275.1| fb14 [Zea mays] >gi|195634903|gb|ACG36920.1| fb14 [Zea mays] >gi|195642958|gb|ACG40947.1| fb14 [Zea mays] >gi|195654547|gb|ACG46741.1| fb14 [Zea mays] >gi|195654947|gb|ACG46941.1| fb14 [Zea mays]
Score 105
Evalue 0.00198012
Total Hit Count 13
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh19n07
CCAGAAGTCGNAGCACCGCCCCTTGTTCCCGTTGATGCCCCANCCGGANGCCATCGCCTCTTCTTCTTCTCCGTCGTCGACCTTGGCAGCCTCTTCTTCT
CTCTCTCCGGTGGTCAGTCACGATGTCGGCACGAGG
page-top