Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh19p21
Contig Information
Length 825 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh19p21   
Homology (BLAST) Top Hit CTP synthase [Zea mays]
Score 536
Evalue 4.6884e-57
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh19p21
AGGAATCAAAGTACACACCCAACAACCCAGGCTCTGTCTCGACAAGACTAAGACTTTCTAAGATGGTCTACCTTATTATTTAGTCCAGACGCAAGGATCA
AAAACATTCGGCTGCATATCAGCACAGAACCTAATACTATACAAGGTGCTCATGTATAAAATGCTAGTCCTCTATTTTTTTCCTAGGCTCTGACCGTCGC
CCTTCTTGTAGGGCCGCCGGCCCTGCTGATAAGTTGCTCAGCCGTTTGTCGCAGTCGACGGGACGATGAGGACCACAGAAGACAGGCGAGATGATCCCCT
TGGCGAAACCGACGGTACGCTAACCATGGGTACTGCCATTGCCGTTGGCATGGCAGGTTCCATTTGCTACACCACCATTGGCTTGCTTCTGCGCGTGCCC
GTTCTGGTGTACTAGGGGTGTTGAGGAGCTGTCACCGAGCTTGTGTTTAGCCGCAACCACATGGCCATTGCAGCTGTCCTGCAGCACCTGATCCAGCTGC
CCACACGCTGCGGCGATTAGTCCGACAAATGGAGGTGAAGGTTTTGAAGGCGTTGACTTGAACTCTGGATGGAATTGGACGCCGACGAAGAACCGGTGAT
CAGGTATTTCAATGATCTCCATTCTCTGTCCAGTCTCGTCCTTGCCAACAAACTGAAGTCCAGCATTTTCAAATGCTGGCACCATATCAGGATTTACCTC
ATATCTGTGCCGATGCCTCTCATCTACGTAGTTGACATCACCATAGAGCTTGGCGGATTTGCAGTCAGTAACCTTGAAAAAATGTTCTCCTTGATCCAAG
GCGCATGGTCCCACCCATATGTGTT
page-top