Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh10b09
Contig Information
Length 826 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh10b09   
Homology (BLAST) Top Hit hypothetical protein OsI_35346 [Oryza sativa Indica Group]
Score 1018
Evalue 9.50999e-109
Total Hit Count 336
Registered year 2003
Contig Sequence     [ Download ]
>whvh10b09
TACTATTTTAGATGGTTTCCTGAAGGTAAAATAGTATTCACAGCCCCTTCGCGTCCTCTTGTCACTCAGCAAATTGAGGCATGCCACAATACAGTGGGTA
TACCGCAGAAGTGGGCGATTGATATGAAAGGGAATCTAAGCCCTTCAATGAGATCAAGCTTGTGGAAGTCTAAACGAGTGTTCTTTGTCACTCCACAGAT
TCTTGAGAATGATATACAATCTGGTATATGCATGGTGAAACAACTTGTTTGCTTGGTGATAGATGAAGCTCATAGAGCTTCGGGAAATCATGCTTACTGT
GTTGCTGTTCGCCAGTTGGTGGCAGCTGGTGTGCCGCTAAGAATTTTAGCTTTGACTGCTACACCAGGATCAAAACAGCCAAATATCCAAGCTGTCATCA
ACAATTTATGCATCTCAGAGTTGATTCATCGTGATGAAAGTGATCTTGAAGTCAAACGATATGTTAACACACGTACAGTTGAACTCTTAAAGGTTCCTGT
TGGCAGTGATACAACTCAAGTCAATGCTATGATTTTGGATCTTATAAATACACATGTTGTTCAGTTACGTGCTGCTGGGGTGATTGATAACAGGGATGCT
GCAAATTGGAGCCCACATCAGTTGCTTATTTTAAGGACGAAATTCAGCCAAGCACCTCCACCAAATATTCCTCTGGAAAAGAAAAAGGAAATTCATAAAT
CTTTTGCAGCTCTCGTGTCACTTTGTCATGTGAGTAAAATGCTTTGGAGCCATGGAATCAAGCCAGCGCACGAGTCAATTAAAGCCAAGTTGAAAGAAGG
GCACTCTTGGAAATTTTGCTTCCAAG
page-top