Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh10g15
Contig Information
Length 640 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh10g15   
Homology (BLAST) Top Hit fatty acid desaturase [Sorghum bicolor]
Score 841
Evalue 1.91708e-88
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whvh10g15
CGTCGCCACCACTCTAACACCGGGTCGCTGGAGCGCGATGAGGTGTTCGTCCCCAAGCAGAAGGAGGCGCTGGCGTGGTACACCCCTTACATCTACAACA
ACCCCGTCGGCCGTCTGGTGCACATCGTCGTGCAGCTCACCCTCGGGTGGCCGCTGTACCTGGCGCTCAACGCCTCAGGCCGCCCGTACCCGCGGTTCGC
CTGCCACTTCGACCCCTACGGCCCGATCTACAACGACCGGGAGCGAGCCCAGATTTTCATCTCAGACGTCGGAGTGCTGGCCGTGTCATTGGCTCTGCTG
AAGCTCGTGTCGTCGTTCGGGTTCTGGTGGGTGGTGCGGGTCTACNGCGTGCCGCTGCTGATCGTGAACGCTTGGCTGGTCCTGATCACCTACCTGCANC
ACACCCACCCGGCGCTGCCGCACTACNACTCNACGGANTGGGACTGGCTGCNNGGGGCGCTGGCCACCATGGACCGCNACTACNGNATCCTCAACCGNNT
GTTCCACAANATCACGGACACNNACNTGNNNCACCANNTATTCTCCANCATGNNNNANTACCACNCCATGNANGNCANNANNGNNATNAANNCNATCCTC
NNNNANTACTANNANNTNNANCCCANCCNNNNNNNNAANG
page-top