Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh19k16
Contig Information
Length 151 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh19k16   
Homology (BLAST) Top Hit hypothetical protein OsJ_015857 [Oryza sativa (japonica cultivar-group)] (no hit)
Score 811
Evalue 1.12091e-84
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh19k16
TGGTGCATATACCAGTCCGACCAGAAAATCATGTCCTTGCAAAGCATTTCAACTGGGCCATTGTTACATTAAACTTCACAGTTTACATATTAGAGATGCC
TTTTTAGGACGAAACAGCAGATGCCGAGGGTTCAGCCTCCCAGAACGATGT
page-top