Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh19l04
Contig Information
Length 905 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh19l04   
Homology (BLAST) Top Hit hypothetical protein OsJ_015857 [Oryza sativa (japonica cultivar-group)]
Score 811
Evalue 1.12091e-84
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh19l04
CATCAGTCCAAAGTATATTTACAAAAAAATATCACAGAATACACAGATATACCCAGGGAAAACTGAGAAATTCAGACATAGGTAACTGAAGTTAGAAAAC
AGATACCTTCAGATAAAAACGCTTGATTATTATCCGGATGGTTTAGAACTACAAAGCTTTTGTGTGACATTCTGGTGATCACCTTTATGAAAAAGAGGAA
GCCCAGGCCCAAACTTAAGCGGGCATATTATATAGCAAACAAAGAAACTTCTCAGTATTTCTCGCTATGTAAATACTACTATTATGTACACCACTAATAA
CCATTTCACGGCGCTACCAAACTGATGCTCTGCTCAAGCAAAACCAGAACTATATATCTGAAGTGATGCATCACTGGATTATTAAGCTACGGTTTTCCGC
AATGTCGTCGAGCCAGGTGACAAGCTGCTGCGACATCGGCCTTGACTTGGGGGCAGCGGTTACGCAGAGGCACGCAATCTCAAGCACCCTCAGCAGCTCG
CCTTCATTCGCCTTGTCATGCACATTCGGGTGAAAAACCTCAGTCTCCCTGTCCTCTTTCCTCATCTGAAGCACCCACGACACGACGTCCCTGCTCCCCT
TGGGCCTGCACATGTCCACAGGCCTCCGGCCGGTGAGCAGCTCCAGCAGCACGATGCCGAAGCTGTAGATGTCGCCCTTGTAAGTCGCGATGGGCGACTG
GGCATACTCTGGAGGAATGTAGCCCAGGGTCCCAACGACATCCGTGGTGACGTGGGTGTCGTACGCGCAGACAAGCCTCGCCAGTCCGAAATCTGCCAGG
TGAGCTTCAAAGTTCTCATCCAGGAGGATGTTGCTTGACTTGATGTCTCGGTGCAGTATGTGTGGCTCACATGACATGTGCAGGTATGCCAACCCCCTTG
CCGAA
page-top