Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whva6h15
Contig Information
Length 725 bp
Tissue Shoot with ABA treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whva6h15   
Homology (BLAST) Top Hit calcium-dependent protein kinase [Triticum aestivum] >gi|164472652|gb|ABY59008.1| calcium-dependent protein kinase [Triticum aestivum]
Score 973
Evalue 1.22864e-103
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whva6h15
CGAGGCCGGATTGGGAGTAGAAAGAGATTCAGGTTTCGATTGGTTTCGTCTGCTCGGCTGACTGGGTTGTAAATTTGGAACTGGAAGGAAGAATTTGAGC
ACAGATGGGCCAGTGTTGCAGCAGAGCTACGTCCCCGGATTCTGTCCAAGGAGGAGCCAATGGCTATGGCTATTCTCACCAGCCCAAACAAGCACAAACA
CCTCCTAGTTACAACAATGCTCAGCCACCACCACAAGCTGAGGTGAGGTACACACCGCCAGCGATGAACCCTCCTGTAGTCCCACCTGTGGTTGCCCCCT
CAAAGCCCATGCCGGACACGATTCTCGGCAAGCAGTACGACGATGTGCGCTCTGTCTACTCGCTTGGCAAGGAACTTGGTAGGGGGCAGTTCGGGGTGAC
GTACCTTTGCACTGAGATTAGCACTGGCAGGCAGTATGCTTGCAAGTCCATATCCAAGCGCAAGCTCGTGAGTAAGGCCGATAAGGAGGATATCCGCAGG
GAGATCCAGATCATGCAGCACCTATCTGGGCAGCCAAACATAGTGGAGTTCTGTGGAGCATACGAGGACAAGGGCAGCGTGCATGTTGTAATGGAGCTCT
GTGCAGGCGGGGAGCTGTTTGATCGGATTATTGCCAAGGGGCACTACTCAGAGCGCGCAGCTGCTACAATCTGCAGAGGAGTTGTGAATGTTGTGAATGT
TTGCCATTTCATGGGAGTGATGCAC
page-top