Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2076
Contig Information
Length 1081 bp
Tissue Seed DPA20
Clones 5 Clones [Download: CSV  ,  FASTA ]
whdp10b08    whdp20k04    rwhdp10b08    rwhdp20k04    rwhdp20k15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glyoxalase II [Brassica juncea]
Score 1119
Evalue 2.87282e-120
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2076
CAATCGGCACATTGTCCAATGTTCTCCAGCGTAAAATCTATCACCAGATGACGAAAACAATGATAACCGGCAAGACAATGAGGAAACAAGAACTGAAGAA
CACTATCAAACAGCTAACTAGCTTTTTCTCTCCCAGGATATAGGATTACACTGACACATTTTATTTGTAGTCGACAAAAGAATCACCAGCTGCTATCAGA
TTAACAAGCACTCTGCGCAAGCTACATACAATGCTAGACAAATTTTCACCAAAGCATTTTTGGAACATCGAGCTATACACATTTCCTTCCCTGCGTTCCT
TCTGTTGTGGTCTTGCCGGGTTCTTTGTCCACTTCTCCTTTTCGAAGAGATGGTTGGGTCATCATTTTATGATAATTTCTTTTGTGGTTAGTCAAAAATT
ATCCTTCGCCCGTCGGATAACTTCAAGAACACGTGCATCATCGAAATGATCTGGAATGGACAGCCTTTTCTTTATCTCTGGACTTGAGGTCCTCAAGAAA
GGATTGCACTGCTTCTCTCTCGCAATTGTTGTTGGCACCGTTGGTGTATTCTTATTGCGCAGATCAGCTGTACTTGCAGCGTATTCCTGAAGTTCTTCAT
TTCCTGGTTCTATGCTCAAGGCAAACCTTGAATTGCTCAGAGTATACTCATGTCCACAGTACACCTTCGTCACATCTGGAAGAGCTACAATTTTTTGGAG
TGAAGAGTGCATCTGTTCTGGAGTCCCCTCAAAAAGCTTTCCACATGATAGACTAAACAAGGTATCACCTGTAAATATTGCTCCAGATCCAGGGAAATAA
AAGCTCACATGACCTGATGTATGACCAGGAGTTTCCATCACAAGAACTTGATGACCCGCAAACATCCATGTGTCACCCTCGCTTAGAGTTATGTCAATGC
CAGGAATTCGATCTTTATCCTTCTCAGAACCAATTACCTTTGCACCATATTTTGCCTTCAGTTCCAAGTTGCCACCAGTATGATCATAGTGATGATGGGT
GTTCAATATGTAGGTCAAGTTCTGGTTTCTCTTTTCCAATGCGTTTATGATAGGCACCGCCTCAGAAGGGTCTACAACTCC
page-top