Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2065
Contig Information
Length 787 bp
Tissue Seed DPA20
Clones 5 Clones [Download: CSV  ,  FASTA ]
whdp10c23    whdp3f14    rwhdp10c23    rwhdp3f14    rwhdp14c11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein L18 [Triticum aestivum]
Score 948
Evalue 1.14512e-100
Total Hit Count 353
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2065
AAAGAGTTGACAGCGATAAGAATCTTGCAAAATATCATTCGAACACTGGGGCGATAGATTTTGCTACTCTCAGTACAAAGTACTTTACTAATTACTGTCA
ATTGCTCAAACAGAACAACAGCCGCTCCACACAAACAGCGACTAACAAGAAAGGGCGACTTAAACCTTGAAGCCACGGCTGTTCCTCCTACCACGAGCCT
TCTCAAACTTCCTACCCTTGGAGCGCACATAGGGCTTGGTGTGGCTGTGCGGCACACCAGGCGCCTTGCCGAAGTGCCTCACCGCCTCACGGGCATTCTT
GGGTCCCCTCAACAGGATCGTGTTCTCCCCAGTTGGAGCACGGAGTGCAAGCTGGTCAAAAGTGAGGCACTCCCCACCAGCATTGACAATCCTTGCCCTC
GCTGTCTCTGTGAACCTCAGAGCGGTAACCTTCATTGCTGGGACCTCTTGGATCCGCATGTCATCTGTGATTGTACCAACAACCACAGCAATGTTCTTCT
CCTCCTTTCCCTTCATGAAGTTGGAGAGGCGGCGCATGGAGAGCGGCGGGCGGTTAGTCTTGCTCATGAAGAGCCTCTTGAGGATGACGGCGTTGAACTT
GCTCTTGGTCCTCCTCACCAGGAAACGGTAGAGCTTGACGAGGAGCTTGAGGTAGACATCGTCGGACTTGGGCGCGACGCGCTTGGTCCTCTTGTTCCTC
CCGCCGGCGACGAGGTCGATACCCATGGCTGCTCCTGCTGCGGCGGCGGTAGGGTTTCCTCGCGGGGTCGCGCTGCGGCTGCTGCTT
page-top