Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhva15a11
Contig Information
Length 881 bp
Tissue Shoot with ABA treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhva15a11   
Homology (BLAST) Top Hit hypothetical protein OsJ_007140 [Oryza sativa (japonica cultivar-group)]
Score 924
Evalue 8.41688e-98
Total Hit Count 80
Registered year 2003
Contig Sequence     [ Download ]
>rwhva15a11
TCATCATGGAAGCAATGAATCAACAAGAGACTCAGGTGGCTAAGCTCCTCTTCCAAAAATAAAACAAGCACACAGCGGCCGATGGAGCATGCGCTATGCT
GTCAGGCCCTCCTTCCATTGTTTTGAATTACATGGTACAAAATCATGAACCCAACACAACCGCCATTCCAACTAAGTCAGCCAGCCACTGGTATCAAATA
CAACCGCTAAGCCACGCTCTTCCCCAAGGGGGCATCACATCTTGATGCAAACAGCGGAGGCTACCCACTTTCTCTCATGCAGTTGCCAGGAAGAAGATAT
CTGTACTGATCAGCCTTCTCGAGCAGATAGGCGGGAAGATGAACCGCCGAATACGTACTTGGGATCGGCCCAAGCTTGGCGATGATCTCTTGGAACGTGT
ACTCCTCCGGAAGCATATCAAAGAGATCAGCCCCTTGGCATATCACATGCTGAATTCTTTTCGGGTTCAAGAAGTAGCTGAACCTGATCCGGTCCACATG
GCTGTAGGCTTTCATTTTGAAGACAAAATCATTTATGTACCGAAAGCAAAAGCTGCAGTGCCACCCTGAGTCTGCCAGAAGGTCGTCAGTTTGCCGGTAA
TGGGCATACCTCGTCTTCCCCGCTCGGTATCTGTGTACCGAAGCCCTCCAACTCTTATCATCAAGCATAAATTGAAACGAGTAGAGATAGTTCTTCAGCT
GAAGGTGAAGTATCTCAGGCGTAAAGTCGCACCATCTCAACAGGTTGATTGTATGGCCACTTGGGATCTCATCAACATCCGACATAATCAACAGGGTCAT
CGTCGGTGATTCCGGCGATCTTTAGAAGCTGGTCAAAGCGCGACTCTCTGATAGGATTCCTCCACAAAATGGGTTCTCCCC
page-top