Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhva15a23
Contig Information
Length 661 bp
Tissue Shoot with ABA treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhva15a23   
Homology (BLAST) Top Hit GL22046 [Drosophila persimilis] >gi|194112025|gb|EDW34068.1| GL22046 [Drosophila persimilis]
Score 83
Evalue 1.60585
Total Hit Count 9
Registered year 2003
Contig Sequence     [ Download ]
>rwhva15a23
ACATATAGCAGATTACATGCACTTATAGAATATGAATATTACAAAGCTTCTTACTTCTCAAATTACAGAGTATTCAGAGAGAGAAAGGGAGAGAAGGCAG
CAGCAAAAAGGTGTAGGAGAAGAGAAGCAGCAGCAGAGGCATGGGCAAGAAGAGAGCAGCAGCAGGAGAAGAAGCAGAGCAAGGGAAGGAGCAGCAGCAA
GACGGAGGAGAGGAGCAGCAGCAGGAAGTTGAGGAGAAGAAGCATCAGCGTGGGGGCTTGGAGAAGGAGCAGAACAACAGCGAGGTAGGGGAAAGTAGAA
GAGCAGCAGCAGTAGGGATTCAGAGAGGAAGCGAGCTTGGAGAAGGATAGCAGCGGGGAGAGTTGTAGACGAGCAGCAGCAGGGGCACGGGGAAGAAGGA
GCAGCAGACAGGGATTCAGAGAAGCGGGGAAGAAGGGAAGAAGAAGCAGCGCGGTGTGTCTGGCCGGGCGCGCCGGCTGGAGGGAGATGTCGCGCGAGGT
GGGCACTGGTGGCTGGCGCTGTGATGGATAGATGATGGTGTGGGTGGTGGATGGCGCGGGTGATGGTGGAGCGAGGTCNCGNAGGCGCNCCGCCACNATG
GCCTGNCCGCNGCGTCNNCCCNATGTGGNANAANCCTCNTGCCNAATTCCTGCNNCCCNNG
page-top